View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_high_61 (Length: 277)
Name: NF2696_high_61
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_high_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-153
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 33641874 - 33641602
Alignment:
| Q |
1 |
gtaaatggttcctcaaactttcttttcctcgatgattcaaattcttctttaacttcagttcttggagtcatggacagtgctttgaataaggataccatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33641874 |
gtaaatggttcctcaaactttcttttcctcgatgattcaaattcttctttaacttcagttcttggagtcatggacagtgctttgaataaggataccatag |
33641775 |
T |
 |
| Q |
101 |
cttcaacaaatggtggatagtggttgtgtgtgtgtatttgttggtgatcaaatgtagcacaatacttgggtgtttatataggatttaatgtgtctatccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33641774 |
cttcaacaaatggtggatagtggttgtgtgtgtgtatttgttggtgatcaaatgtagcacaatacttgggtgtttatataggatttaatgtgtctatccc |
33641675 |
T |
 |
| Q |
201 |
ttggactggtgtaactgcaaaggagaatttaatgtgcgtaaaagttgaaagtccaaatagaaggcctttgctt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33641674 |
ttggactggtgtaactgcaaaggagaatttaatgtgcgtaaaagttgaaagtccaaatagaaggcctttgctt |
33641602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University