View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_high_73 (Length: 250)
Name: NF2696_high_73
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_high_73 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 250
Target Start/End: Complemental strand, 11108420 - 11108189
Alignment:
| Q |
19 |
gacacatttaaataaaaaataaatacaaatgctcaagtggactgcacaaaattaattaggttgcttgatttatactttaaatgattgttaattgattgaa |
118 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11108420 |
gacacatttaaaccaaaaataaatacaaatgctcaagtggcctgtacaaaattaattaggttgcttgatttatactttaaatgattgttaattgattgaa |
11108321 |
T |
 |
| Q |
119 |
aaagaaagaaaaataaacatatttataattcaaccctctgaaaaaaccattatcttgtttgatatatctcatcttgcaatcctaaaccatggttccatta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11108320 |
aaagaaagaaaaataaacatatttataattcaaccctctgaaaaaaccattatcttgtttgatatatctcatcttgcaatcctaaaccatggttccatta |
11108221 |
T |
 |
| Q |
219 |
caaaagttgtcccttgatccatgcttgctttc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11108220 |
caaaagttgtcccttgatccatgcttgctttc |
11108189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University