View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_high_82 (Length: 224)
Name: NF2696_high_82
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_high_82 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 33495833 - 33496026
Alignment:
| Q |
18 |
ttttgcacaaacaaagaagagatgaatgtgggattccgcaaaagtttcacacataacgcatgattcctcgcactgaattcctcttgcattaagattgaca |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33495833 |
ttttgcacaaacaaagaagagattaatgtgggattccgcaaaagtttcacacataacgcatgattcctcgcactgaattcctcttacattaagattgaca |
33495932 |
T |
|
| Q |
118 |
tgggcgggcaagcaatgatgagctaaatgccatataaaggctcgaacacggtgaggaatatcaagattctagatattcatccaaagagaattat |
211 |
Q |
| |
|
||| ||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
33495933 |
cgggtgggcaagaaatgatgagctaaatgccacataaaggctcgaacacggtgaggaatatcgagagtccagatattcatccaaagagaattat |
33496026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 4243743 - 4243561
Alignment:
| Q |
18 |
ttttgcacaaacaaagaagagatgaatgtgggattccgcaaaagtttcacacataacgcatgattcctcgcactgaattcctcttgcattaagattgaca |
117 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| ||||||||||| ||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4243743 |
ttttgcgcaaacaaagaagagatgagtgtggcattccgcaaaattttcaaacataacacatgattcctcgcactggattcctcttgcattaagattgaca |
4243644 |
T |
|
| Q |
118 |
tgggcgggcaagcaatgatgagctaaatgccatataaaggctcgaacacggtgaggaatatcaagattctagatattcatcca |
200 |
Q |
| |
|
| | ||||||||||| |||||||||| |||||| ||||||||| |||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
4243643 |
cgagtgggcaagcaattatgagctaaacgccatagaaaggctcggacacggtgaggaatattgagattccagatattcatcca |
4243561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University