View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2696_high_84 (Length: 220)

Name: NF2696_high_84
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2696_high_84
NF2696_high_84
[»] chr3 (2 HSPs)
chr3 (19-116)||(53842272-53842369)
chr3 (19-99)||(53843992-53844072)


Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 53842369 - 53842272
Alignment:
19 atttcaccctcaactgttgccggagaatgagtcttccgttcgtgttctcacggcgcagaactcgcctaacggaattcaggtataaatgactatttccc 116  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53842369 atttcaccctcaaccgttgcaggagaatgagtcttccgttcgtgttctcacggcgcagaactcgcctaacggaattcaggtataaatgactatttccc 53842272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 99
Target Start/End: Complemental strand, 53844072 - 53843992
Alignment:
19 atttcaccctcaactgttgccggagaatgagtcttccgttcgtgttctcacggcgcagaactcgcctaacggaattcaggt 99  Q
    ||||| |||||||  ||| | ||||||||||||||  |||||||||||||||||||| || | |||||||||||| |||||    
53844072 atttcgccctcaatagttccaggagaatgagtcttttgttcgtgttctcacggcgcacaagttgcctaacggaatccaggt 53843992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University