View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_low_39 (Length: 367)
Name: NF2696_low_39
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 178 - 357
Target Start/End: Complemental strand, 1838207 - 1838020
Alignment:
| Q |
178 |
ataaagacagtttaatccgatgtcattgactctggaaaacaataactttaaagctatcatatcatggcccccaaattaacatctcttggtgaaaaaacaa |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1838207 |
ataaagacagtttaatccgatgtcattgactctggaaaacaataactttaaagctatcatatcatggcccccaaattaacatctcttggtgaaaaaagaa |
1838108 |
T |
 |
| Q |
278 |
acatgtttttaaagttaatttttagaggaatggaagaatagttcaaaattagc--------ggtaaaatgatttaaagaataatctac |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1838107 |
acatgtttttaaagttaatttttagaggaatggaagaatagttcaaaattagcttcatgaaggtaaaatgatttaaagaataatctac |
1838020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 16 - 130
Target Start/End: Complemental strand, 1838367 - 1838253
Alignment:
| Q |
16 |
caacttcttgagcaatcacaatggtattactgcctactttgttggttgggtataaagctacattgacagggacttgcaagatcttccatgactaacctta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1838367 |
caacttcttgagcaatcacaatggtattactgcctactttgttggttgggtataaagctacattgacagggacttgcaagatcttccatgactaacctta |
1838268 |
T |
 |
| Q |
116 |
gataaaagtttggta |
130 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1838267 |
gataaaagtttggta |
1838253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University