View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_low_42 (Length: 353)
Name: NF2696_low_42
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_low_42 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 2e-71; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 209 - 353
Target Start/End: Complemental strand, 53842180 - 53842036
Alignment:
| Q |
209 |
gtcattctttcatgtttggtgttcgatggaactacttttctttgtcatcatctgtcattcagaaagtttatttaggatggtaacgtaaaaaggagaaaat |
308 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53842180 |
gtcattttttcatgtttggtgttcgatggaactacttttctttgtcatcatctgtcattcagaaagtttatttaggatggtaacgtaaaaaggagaaaat |
53842081 |
T |
 |
| Q |
309 |
aataataataatccattatttgttacacatttagcttcctaatcc |
353 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53842080 |
aataatgataatccattatttgttacacatttagcttcctaatcc |
53842036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 53842369 - 53842272
Alignment:
| Q |
19 |
atttcaccctcaactgttgccggagaatgagtcttccgttcgtgttctcacggcgcagaactcgcctaacggaattcaggtataaatgactatttccc |
116 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53842369 |
atttcaccctcaaccgttgcaggagaatgagtcttccgttcgtgttctcacggcgcagaactcgcctaacggaattcaggtataaatgactatttccc |
53842272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 19 - 99
Target Start/End: Complemental strand, 53844072 - 53843992
Alignment:
| Q |
19 |
atttcaccctcaactgttgccggagaatgagtcttccgttcgtgttctcacggcgcagaactcgcctaacggaattcaggt |
99 |
Q |
| |
|
||||| ||||||| ||| | |||||||||||||| |||||||||||||||||||| || | |||||||||||| ||||| |
|
|
| T |
53844072 |
atttcgccctcaatagttccaggagaatgagtcttttgttcgtgttctcacggcgcacaagttgcctaacggaatccaggt |
53843992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University