View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_low_47 (Length: 323)
Name: NF2696_low_47
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 43713010 - 43713157
Alignment:
| Q |
1 |
gcaaacacatggcgtgtgataaggaatttcaataggactttgcggtgaaaaggtttatgggaatgaaactttttaacattattcagataaaaacaattga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43713010 |
gcaaacacatggcgtgtgataaggaatttcaataggattttgcggtgaaaaggtttatgggaatgaaactttttaacattattcagataaaaacaattga |
43713109 |
T |
 |
| Q |
101 |
ttccccttgctaaaatatttaattaatgtgtatttttactccaaataa |
148 |
Q |
| |
|
||| | | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43713110 |
ttcacatcgctaaaatatttaattaatgtgtatttttactccaaataa |
43713157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 142 - 280
Target Start/End: Original strand, 43713192 - 43713333
Alignment:
| Q |
142 |
caaataatttcttttcgtcccttccaaaaaagattttgtgtt---cttttaaaaataaataaacaatcaaatttgtcttta-tttttgtaactcacccta |
237 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
43713192 |
caaataatttcttttcgtcc-ttccaaaaaagattttgtgttgttcttttaaaaataaataaacaatcaaatttgtctctattttttgtaactcacccta |
43713290 |
T |
 |
| Q |
238 |
aaaccagtttctcaagtactcaatccatctgagttggtttgat |
280 |
Q |
| |
|
||||| |||||||||||| ||||||||||| |||| |||||| |
|
|
| T |
43713291 |
aaaccggtttctcaagtagtcaatccatctaggttgatttgat |
43713333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University