View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_low_51 (Length: 309)
Name: NF2696_low_51
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 16 - 298
Target Start/End: Original strand, 13277414 - 13277696
Alignment:
| Q |
16 |
atcaactcaatttcaatttccaacaacaaaaatctctttcatctctctgaactggaatagcagcaaattagagaatccatccttgatctcatctccctct |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13277414 |
atcaactcaatttcaatttccaacagcaaaattctctttcatctctctgaactggaatagcagcaaattagagaatccatcattgatctcatctccctct |
13277513 |
T |
 |
| Q |
116 |
tcgccaaagaaattgttgtcggtggaggcttgttggggtttcttccatttcatagctgagaaataaagccatttcattgttgagaaataaagccataaat |
215 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13277514 |
tcctcaaagaaattgttgtcggtggaggcttgttggggtttcttcgatttcatagctgagaaataaagccatttcattgttgagaaataaagccataaat |
13277613 |
T |
 |
| Q |
216 |
gattggtttttagggtttttctttggggttgttttgatgatgagtttcaaatttggaaaggaggatgtgaaattttgggttga |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13277614 |
gattggtttttagggtttttctttggggttgttttgatgatgagtttcaaattgggaaaggaggatgtgaaattttgggttga |
13277696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 186 - 298
Target Start/End: Complemental strand, 36808619 - 36808507
Alignment:
| Q |
186 |
atttcattgttgagaaataaagccataaatgattggtttttagggtttttctttggggttgttttgatgatgagtttcaaatttggaaaggaggatgtga |
285 |
Q |
| |
|
||||||||||| |||||||||| |||||| ||||||||||||||||||||||| |||| |||||||||||||||||||| ||| ||||| |||||||||| |
|
|
| T |
36808619 |
atttcattgttaagaaataaagtcataaaggattggtttttagggtttttcttgggggctgttttgatgatgagtttcagattgggaaaagaggatgtga |
36808520 |
T |
 |
| Q |
286 |
aattttgggttga |
298 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36808519 |
aattttgggttga |
36808507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University