View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_low_68 (Length: 260)
Name: NF2696_low_68
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_low_68 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 57 - 243
Target Start/End: Complemental strand, 29104890 - 29104704
Alignment:
| Q |
57 |
agaatatggtaaaaccacgtgattaaacatcaagttgagatgcttttgaggttggccaccatgtccataaaatccaaatcccatgtgagagcgtggtttt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29104890 |
agaatatggtaaaaccacgtgattaaacatcaagttgagatgcttttgaggttggccaccatgtccataaaatccaaatcccatgtgagagcgtggtttt |
29104791 |
T |
|
| Q |
157 |
ttagttgccttgtttgattaaacaaatgactagtctcgtgtctggactttggatcaatgtaatggatggagatgagacgagacacgt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29104790 |
ttagttgccttgtttgattaaacaaatgactagtctcgtgtctggactttggatcaatgtaatggatggagatgagacgagacacgt |
29104704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University