View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_low_69 (Length: 260)
Name: NF2696_low_69
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_low_69 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 33641863 - 33642071
Alignment:
| Q |
1 |
ggaaccatttaccgaagaattcttcaaggatcaaacaaatttagagaaaaggaaatccacctttgatacaaagcctcccctagagatcatgtttccttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33641863 |
ggaaccatttaccgaagaattcttcaaggatcaaacaaatttagagaaaaggaaatccacctttgatacaaagcctcccctagagaccatgtttccttca |
33641962 |
T |
 |
| Q |
101 |
aataattggtgccagcaccttggtattcaggtatgtattgtatatatattgtcaaacttcatacataattccaatgatatcatatcttatgatcaatctt |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33641963 |
aataattggtgccaataccttggtattcaggtatgtattgtgtatatattgtcaaacttcatacataattccaatgatatcatatcttatgatcaatctt |
33642062 |
T |
 |
| Q |
201 |
taattatta |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
33642063 |
taattatta |
33642071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University