View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2696_low_78 (Length: 238)

Name: NF2696_low_78
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2696_low_78
NF2696_low_78
[»] chr2 (1 HSPs)
chr2 (1-221)||(19350081-19350301)


Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 19350301 - 19350081
Alignment:
1 tctattcttgcaaactcatgtggtaccattcaaacttgggtgcaaatatcttagaacatggttcaaaatgaatatcgtgcccttattgataagggtgcaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19350301 tctattcttgcaaactcatgtggtaccattcaaacttgggtgcaaatatcttagaacatggttcaaaatgaatatcgtgcccttattgataagggtgcaa 19350202  T
101 ataataaaggcattttgaagcttcataatcaaagtactttaatggcatgtcaaaagctaactattgcctagtttgaagctcttaccaaacaacttaatgc 200  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19350201 ataataaaggcattttggagcttcataatcaaagtactttaatggcatgtcaaaagctaactattgcctagtttgaagctcttaccaaacaacttaatgc 19350102  T
201 ctcttatctagtacaggcaaa 221  Q
    |||||||||||||||||||||    
19350101 ctcttatctagtacaggcaaa 19350081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University