View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_low_79 (Length: 236)
Name: NF2696_low_79
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_low_79 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 168
Target Start/End: Complemental strand, 45793940 - 45793788
Alignment:
| Q |
16 |
aagaacagattttttattttcttgtcttgaacagttgaacgtaaaaaacgtactaaaaaggaataaaactaaagtgagaaatatatatagaaagggagaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45793940 |
aagaacagattttttattttcttgtcttgaacagttgaacgtaaaaaacgtactaaaaaggaataaaactaaagtgagaaatatatatagaaagggagaa |
45793841 |
T |
 |
| Q |
116 |
taagaccagaaatagtacagagaatatcgcgcttaccgaactttctaccagtt |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45793840 |
taagaccagaaatagtacagagaatatcgcgcttaccgaactttctaccagtt |
45793788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 168 - 221
Target Start/End: Complemental strand, 45793757 - 45793704
Alignment:
| Q |
168 |
tcgtcatctggaaagaccatagacattgtaagcaaatatcgacacatcaaagct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45793757 |
tcgtcatctggaaagaccatagacattgtaagcaaatatcgacacatcaaagct |
45793704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University