View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_low_83 (Length: 230)
Name: NF2696_low_83
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_low_83 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 38463721 - 38463932
Alignment:
| Q |
1 |
tgatgctgacctccacaatgtagtggaggcttgtagaggtcatgatactctttcaagtgtgttaactaacattctttcttttgtttattttttagtggac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38463721 |
tgatgctgacctccacaatgtagtggaggcttgtagaggccatgatactctttcaagtgtgttaactaacattctttcttttgtttattttttagtggac |
38463820 |
T |
 |
| Q |
101 |
ttactaaaaatagataaacttagttca-ttttcagcatcatgatatttcctatttaggtttaattttagaattgttaggatacttacttggtaccatgtt |
199 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38463821 |
ttactaaaaatagataaacttagttcatttttcagcatcatgatatttcctatttaggtttaattttggaattgttaggatacttacttggtaccatgtt |
38463920 |
T |
 |
| Q |
200 |
gactggcatacc |
211 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38463921 |
gactggcatacc |
38463932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University