View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2697_high_2 (Length: 584)
Name: NF2697_high_2
Description: NF2697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2697_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 369; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 36 - 436
Target Start/End: Complemental strand, 32288454 - 32288054
Alignment:
| Q |
36 |
ctaagcactaaaaatactatagctagctatgacccatgaccttatatatcaatgcacgcagcttcttcatttctgcttattgccacccatgttcatgttc |
135 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32288454 |
ctaagcactaataatactatagctagctatgacccatgaccttatatatcaatgcacgcagcttcttcatttctgcttattgccacccatgttcatgttc |
32288355 |
T |
|
| Q |
136 |
attccagcattgccacctgcagcaccaccgccgccgccgcccatatttgcttcttgtccaccctgtcctccaccagcatttgcatcgccaaatccaggag |
235 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32288354 |
attccagtattgccacctgcagcaccaccgccgccgccacccatatttgcttcttgtccactctgtcctccaccagcatttgcatcgccaaatccaggag |
32288255 |
T |
|
| Q |
236 |
cagcagtgccatatacagcagtgtattcataccttgaggtggtggtgccatcaggtgttactccggtggcctcataagcgtatgcggtcaccgggtatgc |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32288254 |
cagcagtgccatatacagcagtgtattcataccttgaggtggtggtgccatcaggtgttactccggtggcctcataagcgtatgcggtcaccgggtatgc |
32288155 |
T |
|
| Q |
336 |
ggctactggttccgtaacaccactttggaatgcatcgctcttctgaatatctttttcactatcgcccgttctaggaagattttgaaattgatcgttaggg |
435 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| | ||||||||||||||||||||||||| |
|
|
| T |
32288154 |
ggctactggttccgtaacaccactttggaatgcatcgctcttccgaatatctttttcactatcgtccgttcttgaaagattttgaaattgatcgttaggg |
32288055 |
T |
|
| Q |
436 |
c |
436 |
Q |
| |
|
| |
|
|
| T |
32288054 |
c |
32288054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 480 - 567
Target Start/End: Complemental strand, 32288025 - 32287938
Alignment:
| Q |
480 |
tgtataaattcggcgagtgtgagataatgcgatgttattatatggatcaattcatattcaaaggaaatgcattatatatacttgagag |
567 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
32288025 |
tgtataaattcggcgagtgtgagatcatgcgatgttattatatggatcaattcatattcaagggaaaggcattatatatacttgagag |
32287938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University