View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2697_high_30 (Length: 301)
Name: NF2697_high_30
Description: NF2697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2697_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 19 - 288
Target Start/End: Original strand, 27508169 - 27508438
Alignment:
| Q |
19 |
tttatcgctgccggtgaagaaggaacacttgaagctgttatttgcgcagcttgtaactgtcaccggaacttccaccgcaaagagatcgatggtgaaacgg |
118 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27508169 |
tttattgctgccggtgaagaaggaacacttgaagctgttatttgcgccgcttgtaactgtcaccggaacttccaccgcaaagagatcgatggtgaaacgg |
27508268 |
T |
 |
| Q |
119 |
ttagttcatgtaaccggccacagccaccacctccaccgccgcaataccatcaccacagcaatcaattctcgccttactaccaccgcgctcctccttccac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27508269 |
ttagttcatgtaaccggccacagccaccacctccaccgccgcaataccatcaccacaacaatcaattctcgccttactaccaccgtgctcctccttccac |
27508368 |
T |
 |
| Q |
219 |
agccggttaccttcaccaccatcatcttgcaactccggtggcacatcacagaccgttggctctctctgct |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27508369 |
agccggttaccttcaccaccatcatcttgcaactccggtggcacatcacagaccgttggctctccctgct |
27508438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 49 - 114
Target Start/End: Complemental strand, 35192931 - 35192866
Alignment:
| Q |
49 |
gaagctgttatttgcgcagcttgtaactgtcaccggaacttccaccgcaaagagatcgatggtgaa |
114 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35192931 |
gaagctgttatttgcgccgcttgtaactgtcaccagaacttccaccgcaaagagatcgatggtgaa |
35192866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 49 - 114
Target Start/End: Complemental strand, 44747992 - 44747927
Alignment:
| Q |
49 |
gaagctgttatttgcgcagcttgtaactgtcaccggaacttccaccgcaaagagatcgatggtgaa |
114 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
44747992 |
gaagctgttatttgcgccgcttgtaactgtcaccagaacttccactgcaaagagatcgatggtgaa |
44747927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 26146057 - 26146109
Alignment:
| Q |
19 |
tttatcgctgccggtgaagaaggaacacttgaagctgttatttgcgcagcttg |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||| ||||| |
|
|
| T |
26146057 |
tttatcgctgccggtgaagaaggaacacttgaagttgctatttgcgccgcttg |
26146109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 1148384 - 1148332
Alignment:
| Q |
19 |
tttatcgctgccggtgaagaaggaacacttgaagctgttatttgcgcagcttg |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1148384 |
tttatcgctgccggtgaagaaggaacacttgaagctgttatttgcgccgcttg |
1148332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 25 - 114
Target Start/End: Complemental strand, 46301163 - 46301074
Alignment:
| Q |
25 |
gctgccggtgaagaaggaacacttgaagctgttatttgcgcagcttgtaactgtcaccggaacttccaccgcaaagagatcgatggtgaa |
114 |
Q |
| |
|
|||||||| || ||||||||||| ||||| || ||||| || |||||| ||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
46301163 |
gctgccggagaggaaggaacactggaagcggtgatttgtgctgcttgtggctgtcaccggaacttccaccgcaaagaaatcgacggtgaa |
46301074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 30232370 - 30232421
Alignment:
| Q |
19 |
tttatcgctgccggtgaagaaggaacacttgaagctgttatttgcgcagctt |
70 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30232370 |
tttatcgctgccgatgaagaaggaacacttgaagctgttatttgcgccgctt |
30232421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 137537 - 137589
Alignment:
| Q |
19 |
tttatcgctgccggtgaagaaggaacacttgaagctgttatttgcgcagcttg |
71 |
Q |
| |
|
||||||| || ||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
137537 |
tttatcgatgtcggtgaacaaggaacacttgaagctgttatttgcgccgcttg |
137589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University