View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2697_high_41 (Length: 270)
Name: NF2697_high_41
Description: NF2697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2697_high_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 20 - 190
Target Start/End: Original strand, 36060055 - 36060220
Alignment:
| Q |
20 |
caatgttggtgagtatggcacttattgaacttttatagatgtttcttcttcaaattctaaaaataaaatgtatttcttattgtgaggtccaaaatttgat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
36060055 |
caatgttggtgagtatggcacttattgaacttctatagatgtttcttctt-----tctaaaaataaaatgtacctcttattgtgaggttcaaaatttgat |
36060149 |
T |
 |
| Q |
120 |
cgtccttcttcaccgaggactgcatcacgactgactacattagttttgttgtttatacccaatgaagatga |
190 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36060150 |
cgtccttcttcatcgaggactgcatcacgactgactacattagttttgttgtttatacccaatgaagatga |
36060220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 188 - 254
Target Start/End: Original strand, 36060286 - 36060352
Alignment:
| Q |
188 |
tgagctttagataccagactttccttcacttcatgcttcatgtggtgtctttccctacacgcttctt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36060286 |
tgagctttagataccagactttccttcacttcatgcttcatgtggtgtctttccctacacgcttctt |
36060352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University