View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2697_high_46 (Length: 247)
Name: NF2697_high_46
Description: NF2697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2697_high_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 16 - 120
Target Start/End: Complemental strand, 42677960 - 42677856
Alignment:
| Q |
16 |
aaaaatacccagaagcaaagcgacactatcacaagaaattcagaatttatttaacaagtatatccattctagcaacataaaaacacttccagagtaaaga |
115 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42677960 |
aaaaatacccagaagtaaagagacactatcacaagaaattcagaatttatttaacaagtatatccattctagcaacataaaaacacttccagagtaaaga |
42677861 |
T |
 |
| Q |
116 |
aggga |
120 |
Q |
| |
|
||||| |
|
|
| T |
42677860 |
aggga |
42677856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University