View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2697_high_48 (Length: 245)
Name: NF2697_high_48
Description: NF2697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2697_high_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 83 - 215
Target Start/End: Original strand, 49624089 - 49624221
Alignment:
| Q |
83 |
gatttataaacagccatgatttatcttttggaggattggatacaagtgaagaatgggacttgtagtcgtatagaaaagctgttatacgttttaggggttg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49624089 |
gatttataaacagccatgatttatcttttggaggattggatataagtgaagaatgggacttgtagtcgtatagaaaagctgttatacgttttaggggtta |
49624188 |
T |
 |
| Q |
183 |
gggttttttatttccttaaaccgtaaagcagtt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49624189 |
gggttttttatttccttaaaccgtaaagcagtt |
49624221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University