View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2697_high_58 (Length: 205)
Name: NF2697_high_58
Description: NF2697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2697_high_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 20 - 192
Target Start/End: Complemental strand, 6307824 - 6307659
Alignment:
| Q |
20 |
aaaagtatatggagaagtaataggaactgatcttaatccccgaagcatcctattcaaatttcaagcaagctatccactataaaattggttgagtggaatt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6307824 |
aaaagtatatggagaagtaataggaactgatcttaatccccgaagcatcctattcaa-------gcaagctatccactataaaattggtttagtggaatt |
6307732 |
T |
 |
| Q |
120 |
agacaaagtcaaacacaaaatagagaaaagcaacaaatattattgattgaataattttcccacaatattcttc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||| |||||| |
|
|
| T |
6307731 |
agacaaagtcaaacacaaaatagagaaaagcaacaaatattattgattaaatagttttccaacaattttcttc |
6307659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University