View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2697_low_51 (Length: 247)

Name: NF2697_low_51
Description: NF2697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2697_low_51
NF2697_low_51
[»] chr5 (1 HSPs)
chr5 (16-120)||(42677856-42677960)


Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 16 - 120
Target Start/End: Complemental strand, 42677960 - 42677856
Alignment:
16 aaaaatacccagaagcaaagcgacactatcacaagaaattcagaatttatttaacaagtatatccattctagcaacataaaaacacttccagagtaaaga 115  Q
    ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42677960 aaaaatacccagaagtaaagagacactatcacaagaaattcagaatttatttaacaagtatatccattctagcaacataaaaacacttccagagtaaaga 42677861  T
116 aggga 120  Q
    |||||    
42677860 aggga 42677856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University