View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2697_low_59 (Length: 232)
Name: NF2697_low_59
Description: NF2697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2697_low_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 85 - 130
Target Start/End: Complemental strand, 17349309 - 17349264
Alignment:
| Q |
85 |
ggggtcacgcgagcttaaaatgggcttaaagaccaagtaaaaacta |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17349309 |
ggggtcacgcgagcttaaaatgggcttaaagaccaagcaaaaacta |
17349264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University