View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2698_low_15 (Length: 294)
Name: NF2698_low_15
Description: NF2698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2698_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 3 - 111
Target Start/End: Original strand, 9029830 - 9029938
Alignment:
| Q |
3 |
gtagttaattgacgttgctgaaaagatatttaactaccgttgacaaagacggcaattaattgtcatagctatgagttattgaggccaaactccagagttt |
102 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| | ||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9029830 |
gtagttaattgacgttactgaaaagatagttaactaccgttgatagagacgacaattaattgtcatagctatgagttattgaagccaaactccagagttt |
9029929 |
T |
|
| Q |
103 |
ggctaaaac |
111 |
Q |
| |
|
|||| |||| |
|
|
| T |
9029930 |
ggctgaaac |
9029938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 194 - 258
Target Start/End: Original strand, 9029954 - 9030018
Alignment:
| Q |
194 |
aagtaacactaacattaaaccaaaactcattactttttcaccctatgcgttacttacgcgtcata |
258 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9029954 |
aagtaacactgacattaaaccaaaacccattactttttcaccctatgtgttacttacgcgtcata |
9030018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University