View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2698_low_17 (Length: 282)
Name: NF2698_low_17
Description: NF2698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2698_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 10 - 267
Target Start/End: Complemental strand, 34956148 - 34955895
Alignment:
| Q |
10 |
attatactatatattacaaaattatgacacattgtttatatgcattaatagatattttt-gtcaaaaattatttactcnnnnnnnnnngtttgnnnnnnn |
108 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
34956148 |
attatactatatattacaaaattatggcacattgtttatatgcattaatagatattttttgtcaaaaattatttactcttttttttt-gtttgaaaaata |
34956050 |
T |
 |
| Q |
109 |
tcaataatgtatattggtcaaagatgcttaacacaacacattaattatcgacagttgaatcagtacaatgtgtcatttttatactgctaatgaccatatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34956049 |
tcaataatgtatattggtcaaagatgcttaacacaacacattaattatcgacagttgaattagtacaatgtgtcatttttatactgctaatgaccatatg |
34955950 |
T |
 |
| Q |
209 |
atttagtggtaccatatatacttttaaaaagtaggaataatcgatatcatgttcccatt |
267 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34955949 |
atttagtggtacc----atacttttaaaaagtaggaataatcgatatcatgttcccatt |
34955895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University