View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2698_low_18 (Length: 281)
Name: NF2698_low_18
Description: NF2698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2698_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 269
Target Start/End: Original strand, 39116850 - 39117100
Alignment:
| Q |
19 |
gaacaatacattgtttgcaggctacttggctcatgaattccttacaaaaggaactctgttgggacaacaaatgagctcgatgtcaagctcgagagaggaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39116850 |
gaacaatacattgtttgcaggctacttggctcatgaattccttacaaaaggaactctgttgggacaacaaatgagctcgatgtcaagctcgagagaggaa |
39116949 |
T |
|
| Q |
119 |
ccactgcaacagaagtacaataggtacgtggaggtagcttacttgttgaagtcagatggcacccattttcctgatattgtgaatccgacccaactaggtc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39116950 |
ccactgcaacagaagtacaataggtacgtggaggtagcttacttgttgaagtcagatggcacccattttcctgatattgtgaatccgacccaactaggtc |
39117049 |
T |
|
| Q |
219 |
tagagttaaggttaccctagattcccaaagaactgccatgagccatccctt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39117050 |
tagagttaaggttaccctagattcccaaagaactgccatgagccatccctt |
39117100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University