View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2698_low_21 (Length: 207)
Name: NF2698_low_21
Description: NF2698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2698_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 10 - 183
Target Start/End: Complemental strand, 40585712 - 40585539
Alignment:
| Q |
10 |
gagtgagatgaaactcctcaaggtttgggccaatggtggcattgatccacgtatcaatcgagtggttatagaagggatcgagttgaacgtgatagcatga |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40585712 |
gagtaagatgaaactcctcaaggtttgggccaatggtggcattgatccacgtatcaatcgagtggttatagaagggatcgagttgaacgtgatagcatga |
40585613 |
T |
|
| Q |
110 |
gagacggaactttcgaacaacgcgagatttgcggagagtgaggacagtgttgacgaaaacggagaagatcaaga |
183 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40585612 |
gagacagaacttccgaacaacgcgagatttgcggagagtgaggacagtgttgacgaaaacggagaagatcaaga |
40585539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000004; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 108 - 171
Target Start/End: Complemental strand, 26026577 - 26026514
Alignment:
| Q |
108 |
gagagacggaactttcgaacaacgcgagatttgcggagagtgaggacagtgttgacgaaaacgg |
171 |
Q |
| |
|
|||||||||||||| ||||| ||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
26026577 |
gagagacggaacttccgaacgacgcgtgagcgacggagagagaggacagtgttgacgaaaacgg |
26026514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 171
Target Start/End: Complemental strand, 24933729 - 24933657
Alignment:
| Q |
99 |
tgatagcatgagagacggaactttcgaacaacgcgagatttgcggagagtgaggacagtgttgacgaaaacgg |
171 |
Q |
| |
|
|||| |||||||||||||||||| |||| ||||| || || |||| ||||||||||||||||||||||| |
|
|
| T |
24933729 |
tgatcgcatgagagacggaacttccgaatgacgcgtgagcgacgaagagagaggacagtgttgacgaaaacgg |
24933657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University