View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2699_low_1 (Length: 240)
Name: NF2699_low_1
Description: NF2699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2699_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 35157300 - 35157480
Alignment:
| Q |
14 |
cataggtggttatatttatcatatctacatcagatcaagttgaaaaagacgtacatcatacacaaacatatcatagtctcnnnnnnntcatggagtacat |
113 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35157300 |
cataggtggttatattcatcctatctacatcagatcaagttgaaaaagacgcacatcatacacaaacatatcatagtctcaacaaa-tcatggagtacat |
35157398 |
T |
 |
| Q |
114 |
cattgatactaaaattataattattcttgttacatgtacgtagtttgactataaaggttaagccaaatcttggggaataagc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
35157399 |
cattgatactaaaattataattattcttgttacatgtacatagtttgactaaaaaggttaagccaaatcttggtaaataagc |
35157480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University