View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700-Insertion-10 (Length: 120)
Name: NF2700-Insertion-10
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700-Insertion-10 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 120
Target Start/End: Complemental strand, 37788512 - 37788403
Alignment:
| Q |
8 |
attagtacatgtctctaccaattctgcaggttttgaatctctgccacaaatatatcaggt--gttcacagctaaaaggtgtggctgcacggatcctaaat |
105 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37788512 |
attagtacatgtctctacc-----tgcaggttttgaatctctgccacaaatatatcaggtacgttcacagctaaaaggtgtggctgcacggatcctaaat |
37788418 |
T |
|
| Q |
106 |
atctgatttgtgtag |
120 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37788417 |
atctgatttgtgtag |
37788403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University