View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700-Insertion-14 (Length: 257)
Name: NF2700-Insertion-14
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700-Insertion-14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 8 - 257
Target Start/End: Complemental strand, 38512906 - 38512657
Alignment:
| Q |
8 |
aaatcctactccttcatcagctgctgcaaccaccgcaactcctacaactcccaccccggcaagcacaggtggttcatccaaccttagacctgtcatgatc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38512906 |
aaatcctactccttcatcagctgctgcaaccaccgcaactcctacaactcccaccccggcaagcacaggtggttcatccaaccttagacctgtcatgatc |
38512807 |
T |
|
| Q |
108 |
aacaacgtgatgacggtgattttggccattgttcttgctgcagtacctgctggatttatcagcatttatacatgatgggttggatgtttgaatgcttcac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38512806 |
aacaacgtgatgacggtgattttggccattgttcttgctgcagtacctgctggatttatcagcatttatacatgatgggttggatgtttgaatgcttcac |
38512707 |
T |
|
| Q |
208 |
ctaaccacagtgaaatatggttagaaagtagtaaagtattggttggttga |
257 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38512706 |
ctaaccacagtgaaatatggttaggaagtagtaaagtattggttggttga |
38512657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University