View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700-Insertion-4 (Length: 384)
Name: NF2700-Insertion-4
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700-Insertion-4 |
 | |
|
| [»] scaffold0606 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0606 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: scaffold0606
Description:
Target: scaffold0606; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 10 - 384
Target Start/End: Complemental strand, 6567 - 6179
Alignment:
| Q |
10 |
tttgacctactttgcaatagagaaaatattctcatgatggatgaggttatatgaaacataaatttcaaccaatttcaaagttgttgattcttttagatta |
109 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
6567 |
tttgaccaactttgcaatagagaaaatattcacatgatggatgaggttatatgaaacataaatttcaatcattttcaaagttgttgattcttttagatta |
6468 |
T |
|
| Q |
110 |
ataaatatatacttcaaaaaggtttgtgtaatttgagaaagaagatataatttagc--------------atagatactaacttgtctcttttaaattat |
195 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
6467 |
ataaatatatgcttcaaaaaggtttgtgtaatttgagaaagaagatataatttagcgatttacatcaggtatagatactaacttgtctctttcaaattat |
6368 |
T |
|
| Q |
196 |
ttccacggaccatactgtcagaaaccatctcttccaacaaacaggaacaatatttgtagcttattctttccaatactataccagactcaatatgcatggc |
295 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6367 |
ttccacggaccatattgtcagaaaccatctcttccaacaaacaggaacaatatttgaagtttattctttccaatactataccagactcaatatgcatggc |
6268 |
T |
|
| Q |
296 |
tgcatttttattggaaaagataccacatgtttcactaaatatgagcttttaatctctatcataaattctgatctagtggttataaatga |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6267 |
tgcatttttattggaaaagataccacatgtttcactaaatatgagcttttaatctctatcgtaaattctgatctagtggttataaatga |
6179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 104
Target Start/End: Original strand, 16918189 - 16918274
Alignment:
| Q |
18 |
actttgcaatagagaaaatattctcatgatggatgaggttatatgaaacataaatttcaaccaatttcaaagttgttgattctttta |
104 |
Q |
| |
|
|||||||||||||||||| |||| | |||| || |||||| |||| ||||| |||||||| |||| ||||||||||||||||||||| |
|
|
| T |
16918189 |
actttgcaatagagaaaa-attcacttgatagaggaggttgtatgcaacattaatttcaatcaatctcaaagttgttgattctttta |
16918274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 10 - 92
Target Start/End: Original strand, 16636696 - 16636779
Alignment:
| Q |
10 |
tttgacctactttgcaatagagaaaatattctcatgatggatgagg-ttatatgaaacataaatttcaaccaatttcaaagttg |
92 |
Q |
| |
|
||||||| | ||||||||||||||||||| | | ||||||| |||| ||||||| |||||| ||| ||| |||| ||||||||| |
|
|
| T |
16636696 |
tttgaccaaatttgcaatagagaaaatatccacttgatggaggaggtttatatgcaacatatattgcaatcaatctcaaagttg |
16636779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University