View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700-Insertion-9 (Length: 173)
Name: NF2700-Insertion-9
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700-Insertion-9 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 5e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 5e-67
Query Start/End: Original strand, 8 - 173
Target Start/End: Complemental strand, 25626656 - 25626499
Alignment:
| Q |
8 |
aattcaatatgattgaatggggttatggcaaaaatgggattacaaaataataaaagattatgtaaccctaacaatcgctaattaaaacaagataagccgt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25626656 |
aattcaatatgattgaatggggttatggcaaaaatgggattacaaaa--------gattatgtaaccctaacaattgctaattaaaacaagataagccgt |
25626565 |
T |
|
| Q |
108 |
tagcctcctataaaattacattcttcctattgctcaaacaaatgctcatatttgacttttacttca |
173 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25626564 |
tagcctcctctaaaattacattcttcctattgctcaaacaaatgctcatatttgacttttacttca |
25626499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University