View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700R-Insertion-17 (Length: 321)
Name: NF2700R-Insertion-17
Description: NF2700R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700R-Insertion-17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 9 - 165
Target Start/End: Complemental strand, 5752614 - 5752458
Alignment:
| Q |
9 |
cgaagtagtctcgttgagctcgcaccaaattaggtggcaacctttcccttctataagtgtcaaaatatgcaagactagcatacatgcctgggatgctgat |
108 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||| || |||| |||||| |
|
|
| T |
5752614 |
cgaagtagtctcgttgagcttgcaccaaattagctggcaacctttcccttctataagagtcaaaatatgcaagactagcagacatacccgggaggctgat |
5752515 |
T |
|
| Q |
109 |
acctgaattgacagcaagggaaacgactctcctccatgcggtttggcattcaattat |
165 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
5752514 |
acctgaattgacagcaagggaaacaactctcctccatgcggtttggcgttcaattat |
5752458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 243 - 321
Target Start/End: Complemental strand, 5752355 - 5752277
Alignment:
| Q |
243 |
tcctttccaaatacgggcaagttcacccaatgccaaatcccatcccttttcagtgctctttgcactgatcagattcatc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||| |||||||||| ||||||||||||| |
|
|
| T |
5752355 |
tcctttccaaatacgggcaagttcacccaattccaaatcccaacccttttcagcactctttgcacggatcagattcatc |
5752277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University