View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700R-Insertion-18 (Length: 297)
Name: NF2700R-Insertion-18
Description: NF2700R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700R-Insertion-18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 20 - 128
Target Start/End: Complemental strand, 37082552 - 37082444
Alignment:
| Q |
20 |
aaaaataaaattgattgatcttctccatgattgtctacccgtgcatagatcataaaaaattaaattgatttaccgtctctagattgcctacccgttcgkc |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37082552 |
aaaaattaaattgattgatcttctccatgattgtcttcccgtgcatagatcataaaaaattaaattgatttatcgtctctagattgcctacccgttcgta |
37082453 |
T |
|
| Q |
120 |
gatcaacat |
128 |
Q |
| |
|
||||||||| |
|
|
| T |
37082452 |
gatcaacat |
37082444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 175 - 291
Target Start/End: Complemental strand, 37082445 - 37082327
Alignment:
| Q |
175 |
attgacaaaacattagaacaggtggaagggggttggaaaacacccctcttt-atgctctcgtcg-cccgtctttgcctatgaaccgccaggttactaaat |
272 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| | ||||||||| |
|
|
| T |
37082445 |
attgacaaaacattataacaagtggaagggggttggaaaacacccctctttgatgctctcgtcgccccgtctttgcctatgaaccgcccgattactaaat |
37082346 |
T |
|
| Q |
273 |
aaatattggatcttgttaa |
291 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
37082345 |
aaatattgggtcttgttaa |
37082327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University