View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700R-Insertion-19 (Length: 230)
Name: NF2700R-Insertion-19
Description: NF2700R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700R-Insertion-19 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 8 - 230
Target Start/End: Complemental strand, 42685436 - 42685214
Alignment:
| Q |
8 |
agaaagcacctatgataccaattggtatatgttaagattgaaggaaaaatgcaattatagaacatgagatcacgagagccaaacaagtttcaaggtttca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42685436 |
agaaagcacctatgataccaattggtatatgttaagattgaaggaaaaatgcaattatagaacatgagatcacgagagccaaacaagtttgaaggtttca |
42685337 |
T |
 |
| Q |
108 |
ccatttagaaattccaattttttaggaaactctattatgaagtgatatttggaagtttgttgagaatttgatggaagtgaaatgaaagagtcaaatccct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42685336 |
ccatttagaaattccaattttttaggaaactctattatggagtgatatttggaagtttgttgagaatttgatggaagtgaaatgaaagagtcaaatccct |
42685237 |
T |
 |
| Q |
208 |
gactcgctgccacctactcactc |
230 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42685236 |
gactcgctgccacctactcactc |
42685214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University