View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_high_28 (Length: 383)
Name: NF2700_high_28
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 14 - 369
Target Start/End: Original strand, 41171399 - 41171755
Alignment:
| Q |
14 |
atgaaacttttattccaaggttcttaggccaatattgtaaaaagagatgggtaattttgactactattcttcggtagtttttgctcattttggagtgggc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41171399 |
atgaaacttttattccaaggttcttaggccaatattgtaaaaagagatgggtaattttgactactattcttcggtagtttttgctcattttggagtgggc |
41171498 |
T |
|
| Q |
114 |
ccctcaatacacccttagttcttgaaatcagaccttattgctgggaccaccac-atattgctactttgactattcagcaaggtgcaattgtatctaattt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41171499 |
ccctcaatacacccttagttcttgaaatcagaccttattgctgggaccaccactatattgctactttgactattcagcaaggtgcaattgtatctaattt |
41171598 |
T |
|
| Q |
213 |
taggttatgcagatatttcgaaagtgtggttataatgtggattaccatgcactatcttgagttttcattgcaacattcattttcttgattggatatgtag |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41171599 |
taggttatgcagatatttcgaaagtgtggttataatgtggatcaccatgcactatcttgagttttcattgcaacattcattttcttgattggatatgtag |
41171698 |
T |
|
| Q |
313 |
gacaacaaatttcctctcaaatcaatactgaatatttaatttacaaatgataacaat |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41171699 |
gacaacaaatttcctctcaaatcaatactgaatatttaatttacaaatgataacaat |
41171755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 94 - 165
Target Start/End: Complemental strand, 38221340 - 38221268
Alignment:
| Q |
94 |
ttgctcattttggagtgggcccctcaatacaccctt-agttcttgaaatcagaccttattgctgggaccacca |
165 |
Q |
| |
|
|||| ||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38221340 |
ttgcccatcttggagtgggccccacaatacacccttcagttcttgaaatcagaccttattgctgggatcacca |
38221268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University