View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_high_41 (Length: 329)
Name: NF2700_high_41
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_high_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 16 - 307
Target Start/End: Complemental strand, 42533841 - 42533550
Alignment:
| Q |
16 |
caccatgtacagcctcttgtaaccaccgagagccaccacaactggccggacggaagctggtggtggagtggagacatggcggaagcagaggtgttcccag |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42533841 |
caccatgtacagcctcttgtaaccacccagagccaccacgactggccggacggaagctggtggtggagtggagacatggcggaagcagaggtgttcccag |
42533742 |
T |
 |
| Q |
116 |
attgagtcgtctttggttgttaagttgcaccataagcgacagacacatgatgctacaccgagtgatggaccgtcgaggcgtttaaggatttctcgtagaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42533741 |
attgagtcgtctttggttgttaagttgcaccataagcgacagacacatgatgctacaccgagtgatggaccgtcgaggcgtttaaggatttctcgtagaa |
42533642 |
T |
 |
| Q |
216 |
tgtcgatgttgtcgtttatgaagaacttgtgtcttttactttgttgttgtgtccttgaagtggttcttcttgttccttcttgcatgtattca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42533641 |
tgtcgatgttgtcgtttatgaagaacttgtgtcttttactttgttgttgtgtccttgaagtggttcttcttgttccttcttgcatgtattca |
42533550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University