View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_high_48 (Length: 305)
Name: NF2700_high_48
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_high_48 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 303
Target Start/End: Complemental strand, 34075196 - 34074894
Alignment:
| Q |
1 |
cgcaaagggcaggcatgttatgatcacatggttatgctttcaaaatgcaaaacatgttttgcatcttaaataaacattatgagcaatattttaaatgttt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34075196 |
cgcaaagggcaggcatattatgatcacatggttatgctttcaaaatacaaaacatgttttgcatcttaaataaacattatgagtaatattttaaatgttt |
34075097 |
T |
|
| Q |
101 |
aagtgcagtaagattttctcttgtgtaccatttctgcataagtactcataaaatttgtaaaacttaaatatactgatcagtaataaatatacccaggaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34075096 |
aagtgcagtaagattttctcttgtgtaccatttctgcataagtactcataaaatttgtaaaacttaaatatactgatcagtaataaatatacccaggaac |
34074997 |
T |
|
| Q |
201 |
ttcgggctatggtggaatcatctgcaattttagtttgtttggctgctttggctattgtggtcacactacaaacaataaagcagagctaatggcaaccgac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34074996 |
ttcgggctatggtggaatcatctgcaattttagtttgtttggctgctttggctattgtggtcacactacaaacaataatgcagagctaatggcaaccgac |
34074897 |
T |
|
| Q |
301 |
cgc |
303 |
Q |
| |
|
||| |
|
|
| T |
34074896 |
cgc |
34074894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University