View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_high_57 (Length: 285)
Name: NF2700_high_57
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_high_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 34074840 - 34074562
Alignment:
| Q |
1 |
ctctcagtcgacgttgcttttttggagtatgaccaccccttgagtcgcccatgtgaaccattggtttccaatatcaagaggtgcttatcttacgattgaa |
100 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34074840 |
ctctcagccgacgttgcttttttggaggatgaccaccccttgagtcgcccatgtgcaccgttggtttccaatatcaagaggtgcttatcttacgattgaa |
34074741 |
T |
 |
| Q |
101 |
atcttagttttactcacacattcttcatgaagggaatgcttgtgcggat-----------gcatgatgtcttttctatgcagattgttgtcatttttcaa |
189 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
34074740 |
atcttagttttactcacacattcttcgtgaagggaatgcttgtgcggattggtttgctaagcatgatgtcttttctatgcaggttgttgtca-ttttcaa |
34074642 |
T |
 |
| Q |
190 |
tcttgttctactcaactttcttcaactcttcttgctgatgcaatgtgagttagtttcttgagagcttagttttgtttggt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34074641 |
tcttgttctactcaactttcttcaactcttcttgctgatgcaatgtgagttagtttcttgagagcttagttttgtttggt |
34074562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 218 - 267
Target Start/End: Complemental strand, 37421003 - 37420953
Alignment:
| Q |
218 |
ttcttgct-gatgcaatgtgagttagtttcttgagagcttagttttgtttg |
267 |
Q |
| |
|
|||||||| ||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
37421003 |
ttcttgctcgatgcaatgggagttaattttttgagagcttagttttgtttg |
37420953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University