View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_high_68 (Length: 256)
Name: NF2700_high_68
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_high_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 50329498 - 50329602
Alignment:
| Q |
1 |
taatattgactgtttgatcatttgatgcttatttcaagatactggctatgcgacacccacgacgccttgtcttaacgggttgcctcgcagctttgatagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50329498 |
taatattgactgtttgatcatttgatgcttatttcaagatactggctatgcgacacccacgacgccttgtcttaacgggttgcctcgcagctttgatagt |
50329597 |
T |
|
| Q |
101 |
aagaa |
105 |
Q |
| |
|
||||| |
|
|
| T |
50329598 |
aagaa |
50329602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 158 - 245
Target Start/End: Original strand, 50329656 - 50329743
Alignment:
| Q |
158 |
aaagtagtggtattttggttattattttaattctcatagttccttgtaaaattttgaattataggtgatgacaattctctctgttctt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50329656 |
aaagtagtggtattttggttattattttaattctcatagttccttgtaaaattttgaattataggtgatgacaattctctctgttctt |
50329743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University