View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_high_72 (Length: 246)
Name: NF2700_high_72
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_high_72 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 113 - 221
Target Start/End: Original strand, 37082444 - 37082552
Alignment:
| Q |
113 |
atgttgatcgacgaacgggtaggcaatctagagacgataaatcaatttaattttttatgatctatgcacgggtagacaatcatggagaagatcaatcaat |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37082444 |
atgttgatctacgaacgggtaggcaatctagagacgataaatcaatttaattttttatgatctatgcacgggaagacaatcatggagaagatcaatcaat |
37082543 |
T |
 |
| Q |
213 |
tttattttt |
221 |
Q |
| |
|
|| |||||| |
|
|
| T |
37082544 |
ttaattttt |
37082552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 37082379 - 37082552
Alignment:
| Q |
1 |
gggcgacgagagcat-aaagaggggtgttttccaacccccttccacctgttctaatgttttgtca------atctacacatctgataggcaatctagaga |
93 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||| |||||| | | | ||||||||||||||| |
|
|
| T |
37082379 |
gggcgacgagagcatcaaagaggggtgttttccaacccccttccacttgttataatgttttgtcaatgttgatctac-gaacgggtaggcaatctagaga |
37082477 |
T |
 |
| Q |
94 |
tgataaatcattttaatttatgttgatcgacgaacgggtaggcaatc-tagagacgataaatcaatttaattttt |
167 |
Q |
| |
|
||||||||| |||||||| | ||||| | | ||||| || ||||| | |||| ||| |||||||||||||||| |
|
|
| T |
37082478 |
cgataaatcaatttaattttttatgatctatgcacgggaagacaatcatggagaagatcaatcaatttaattttt |
37082552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University