View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2700_high_72 (Length: 246)

Name: NF2700_high_72
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2700_high_72
NF2700_high_72
[»] chr2 (2 HSPs)
chr2 (113-221)||(37082444-37082552)
chr2 (1-167)||(37082379-37082552)


Alignment Details
Target: chr2 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 113 - 221
Target Start/End: Original strand, 37082444 - 37082552
Alignment:
113 atgttgatcgacgaacgggtaggcaatctagagacgataaatcaatttaattttttatgatctatgcacgggtagacaatcatggagaagatcaatcaat 212  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
37082444 atgttgatctacgaacgggtaggcaatctagagacgataaatcaatttaattttttatgatctatgcacgggaagacaatcatggagaagatcaatcaat 37082543  T
213 tttattttt 221  Q
    || ||||||    
37082544 ttaattttt 37082552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 37082379 - 37082552
Alignment:
1 gggcgacgagagcat-aaagaggggtgttttccaacccccttccacctgttctaatgttttgtca------atctacacatctgataggcaatctagaga 93  Q
    ||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||      ||||||  | | | |||||||||||||||    
37082379 gggcgacgagagcatcaaagaggggtgttttccaacccccttccacttgttataatgttttgtcaatgttgatctac-gaacgggtaggcaatctagaga 37082477  T
94 tgataaatcattttaatttatgttgatcgacgaacgggtaggcaatc-tagagacgataaatcaatttaattttt 167  Q
     ||||||||| |||||||| |  ||||| | | ||||| || ||||| | |||| ||| ||||||||||||||||    
37082478 cgataaatcaatttaattttttatgatctatgcacgggaagacaatcatggagaagatcaatcaatttaattttt 37082552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University