View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_high_78 (Length: 235)
Name: NF2700_high_78
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_high_78 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 80 - 220
Target Start/End: Complemental strand, 41308421 - 41308297
Alignment:
| Q |
80 |
tttcttttagatattcatataagttatgagacctgttattctgtgaagcagattagcaaatgaccattagcattaagatgctcccaattctacttgcctt |
179 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41308421 |
tttcttttagatattcatatgagttatgagacctgttattctgtgaagcagattagcaaa----------------gatgctcccaattctacttgcctt |
41308338 |
T |
 |
| Q |
180 |
gcacagtacggtgtgttgttttctaaaaatattgttgattc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41308337 |
gcacagtacggtgtgttgttttctaaaaatattgttgattc |
41308297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University