View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_high_9 (Length: 609)
Name: NF2700_high_9
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 354; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 159 - 574
Target Start/End: Complemental strand, 43760493 - 43760060
Alignment:
| Q |
159 |
gggtacccgtcttgtgaatgtgaagcaaaagcacaaaaaattcaagttgaacaccgaccctccagctattaaggacacccttaagtccaaaactcaaagt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43760493 |
gggtacccgtcttgtgaatgtgaagcaaaagcacaaaaaattcaagttgaacaccgaccctccagctattaaggacacccttaagtccaaaactcaaagt |
43760394 |
T |
|
| Q |
259 |
gcagtgaaccaaagcaaaagaggagggtgtagctggcagta---ccctggttcaagacacgagagaaaatggcggaagaagaaagagagattgtgtcgtg |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43760393 |
gcagtgaaccaaagcaaaagaggagggtgtagctggcagtagtaccctggttcaagacacgagagaaaatggcggaagaagaaagagagattgtgtcgtg |
43760294 |
T |
|
| Q |
356 |
tcaccctttgagaaaacaaaacaagcctcgagatttgaggttattgggattgaaaaaacaacaagtgcaattagaagaagatgaagaacaacatacacgc |
455 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43760293 |
tcaccctttgagaaaacaaaacaagcctcgagatttgaggttattgggattgaaaaaacaaaaagtgcaattagaagaagatgaagaacaacacacacgc |
43760194 |
T |
|
| Q |
456 |
acgcaggagcgacaaagaaacacgagcggcgcgacccgagaaacaagaacaagctaggcta---------------ctactgcttctcttgtctgtctct |
540 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
43760193 |
acgcaggagcgacaaacaaacacgagcggcgcgacccgagaaacaagaacaagctaggctactacaactactgctactactacttctcttgtctgtctct |
43760094 |
T |
|
| Q |
541 |
gcaacaaccaccactctatactaaaacaacaaca |
574 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43760093 |
gcaacaaccaccactctatactaaaacaacaaca |
43760060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 43760637 - 43760595
Alignment:
| Q |
1 |
aagaggtttttgcatgttgtgaaaaactcaaacctaggatccc |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43760637 |
aagaggtttttgcatgttgtgaaaaactcaaacctaggatccc |
43760595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University