View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_low_45 (Length: 325)
Name: NF2700_low_45
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 29274252 - 29273944
Alignment:
| Q |
1 |
acatgtttcatgcaagttcggtggttgaatcacgttcaatgatcgtgttgggaggatcgcaagagatagtgccgtaaatccactgtaaacacaa--acat |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29274252 |
acatgtttcatgcaagttcggtggttgaatcacgttcaatgattgtgttgggaagatcgcaagagatagtgccgtaaatccactgtaaacacaacaacat |
29274153 |
T |
 |
| Q |
99 |
caaagacatgaaatcgacttcttatcattctttgaaggaggaatgatatgatcaagaacacgataagccctaacatggattttaaagagcatcggccaag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29274152 |
caaagacatgaaatcgacttcttatcattctttgaaggaggaattgtatgatcaagaacacgataagccctaacatggattttaaagagcatcggccaag |
29274053 |
T |
 |
| Q |
199 |
taactctattcagtatctaacgtggctttgatgaagttgataatattaaggatcataagagcgggaaggaggagtaggtgaggtaggagaaggattagtc |
298 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29274052 |
taaccctattcagtatctaacgtggctttgatgaagttgataatattagggatcataagagcgggaaggaggagtaggtgaggtaggagaaggattagtc |
29273953 |
T |
 |
| Q |
299 |
gatgggtat |
307 |
Q |
| |
|
||||||||| |
|
|
| T |
29273952 |
gatgggtat |
29273944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University