View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_low_48 (Length: 312)
Name: NF2700_low_48
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 20 - 296
Target Start/End: Original strand, 11351560 - 11351836
Alignment:
| Q |
20 |
aggtaatccaaacactacgcaattttgttgtattttcagttgaattttgataacccttttgtgcttaattactctaaattgctttctgtttcctacttgt |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11351560 |
aggtaatccaagcactacgcaattttgttgtatttttagttgaattttgataacccttttatgcttaattactctaaattgctttctgtttcctacttgt |
11351659 |
T |
|
| Q |
120 |
tgcagaggcaaatatgctatacttggaatcgcctgctggtgttggtttctcctattctacaaatgaatcattctacgactccgtgaatgattatttgaca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11351660 |
tgcagaggcaaatatgctatacttggaatcgcctgctggtgttggtttctcctattctacaaatgaatcattctacgactccgtgaacgattatttgaca |
11351759 |
T |
|
| Q |
220 |
ggnnnnnnnaacttctttatgtgcaaaatagcatgtgaatggtaggtatcacaagaagttgagttgaattattaact |
296 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11351760 |
ggtttttttaacttctttatgtgcaaaatagcatgtgaatggtagttatcacaagaagttgagttgaattattaact |
11351836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University