View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_low_51 (Length: 305)
Name: NF2700_low_51
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_low_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 279
Target Start/End: Original strand, 779930 - 780197
Alignment:
| Q |
18 |
atgagtttattgaacttatcacatttaatttgtccgacacatgttagacatcatagacgtcatctatcataagtgtatgtgctataaagctaatgaccta |
117 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
779930 |
atgagtttattgaacttatcacagtt-----gtccgacacatgttagacatcatagacgtcatctatcataagtgtatgtgctataaagctaatgaccta |
780024 |
T |
|
| Q |
118 |
gacaatccatcaacaaacagtgacgaagctggttggaaaccgtt-------taggaatcaatttgattgtgcgtgatggaatcaattttgtgttttatat |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
780025 |
gacaatccatcaacaaacagcgacgaagctggttggaaaccgtttaaatactaggaatcaatttgattgtgcatgatggaatcaattttgtgttttatat |
780124 |
T |
|
| Q |
211 |
cacttaactattcat----tactggaatagtaacaaataacactaaatggttatcaactttactattttaagg |
279 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
780125 |
cacttaactattcattagctactggaatagtaacaaataacactaaatggttatcaactttactattttaagg |
780197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University