View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_low_62 (Length: 283)
Name: NF2700_low_62
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_low_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 46 - 208
Target Start/End: Complemental strand, 45054782 - 45054620
Alignment:
| Q |
46 |
ttgatcctttatcttttttaaatgattcacatttgtccatctgttatccattagagaaaattagaaactaaactcatgtggcttctagcatgtcaaacac |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45054782 |
ttgatcctttatcttttttaaatgattcacatttgtccatctgttatccattagagaaaattagaaactagactcatgtggcttctagcatgtcaaacac |
45054683 |
T |
 |
| Q |
146 |
gttgcataacttcaatctccttcacgtattaaactttcgttaacttatgttatgatttctaac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45054682 |
gttgcataacttcaatctccttcacgtattaaactttcgttaacttatgttatgatttctaac |
45054620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 45054855 - 45054796
Alignment:
| Q |
1 |
gtttaaatatatttttcgtcctttagcgtattccaaaaatgtgttttgatcctttatctt |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
45054855 |
gtttaaatatatttttcgtcctttagcgtatttcaaaaatatgttttgatcctttatctt |
45054796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 114 - 169
Target Start/End: Complemental strand, 45054524 - 45054469
Alignment:
| Q |
114 |
taaactcatgtggcttctagcatgtcaaacacgttgcataacttcaatctccttca |
169 |
Q |
| |
|
||||||||| ||||||| ||| ||||||||| |||||| ||||||||||||||||| |
|
|
| T |
45054524 |
taaactcatatggcttccagcttgtcaaacatgttgcaaaacttcaatctccttca |
45054469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 208
Target Start/End: Complemental strand, 44005616 - 44005579
Alignment:
| Q |
171 |
gtattaaactttcgttaacttatgttatgatttctaac |
208 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
44005616 |
gtattaaactttagttaacttatggtatgatttctaac |
44005579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 34 - 74
Target Start/End: Complemental strand, 29069534 - 29069494
Alignment:
| Q |
34 |
caaaaatgtgttttgatcctttatcttttttaaatgattca |
74 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| |||||| |
|
|
| T |
29069534 |
caaaaatgtgttttggtcctttatctttttaaaaagattca |
29069494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University