View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_low_63 (Length: 282)
Name: NF2700_low_63
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_low_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 264
Target Start/End: Complemental strand, 38122784 - 38122537
Alignment:
| Q |
17 |
aatatagagtaacagtttagaagaataagcaccggctttaatcaatgatctttgtgtggtttcgtttgttttattttaggagatatggttgagttttatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38122784 |
aatatagagtaacagtttagaagaataagcaccggctttaatcaatgatctttgtgtggtttcgtttgttttattttaggagatatggttgagttttatt |
38122685 |
T |
 |
| Q |
117 |
ggtggtgggacatagatatcagataaacattatcttactatgttgactcaattgactcnnnnnnngacttcatgctcttaaaccattgtcttgtagaata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38122684 |
ggtggtgggacatagatatcagataaacattatcttactatgttgactcaattgactctttttttgacttcatgctcttaaaccattgtcttgtagaata |
38122585 |
T |
 |
| Q |
217 |
tgcatgtggtccttttgaaactttgattattgaatgtatgttaaaact |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38122584 |
tgcatgtggtccttttgaaactttgattattgaatgtatgttaaaact |
38122537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University