View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2700_low_69 (Length: 269)

Name: NF2700_low_69
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2700_low_69
NF2700_low_69
[»] chr8 (1 HSPs)
chr8 (19-138)||(2029068-2029187)


Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 19 - 138
Target Start/End: Original strand, 2029068 - 2029187
Alignment:
19 cttttaactttaaaataactctaaaagtgacctaaaaatcatatatgatttcctttcatcaataaaataaattatcatatttgttatcttgtccacaaca 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
2029068 cttttaactttaaaataactctaaaagtgacctaaaaatcatatatgatttcctttcttcaataaaataaattatcatatttgttatcttgtccacaaca 2029167  T
119 aatatattgtatgataacta 138  Q
    ||||||||||||||||||||    
2029168 aatatattgtatgataacta 2029187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University