View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_low_69 (Length: 269)
Name: NF2700_low_69
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_low_69 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 19 - 138
Target Start/End: Original strand, 2029068 - 2029187
Alignment:
| Q |
19 |
cttttaactttaaaataactctaaaagtgacctaaaaatcatatatgatttcctttcatcaataaaataaattatcatatttgttatcttgtccacaaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2029068 |
cttttaactttaaaataactctaaaagtgacctaaaaatcatatatgatttcctttcttcaataaaataaattatcatatttgttatcttgtccacaaca |
2029167 |
T |
 |
| Q |
119 |
aatatattgtatgataacta |
138 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2029168 |
aatatattgtatgataacta |
2029187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University