View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_low_73 (Length: 252)
Name: NF2700_low_73
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_low_73 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 7e-61; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 20 - 142
Target Start/End: Complemental strand, 37788759 - 37788637
Alignment:
| Q |
20 |
gcaatcaactttttgtcttcctcatgtgtccatgaaccttttctcaatccattattgtcacaaggggttctcaccatggtcactacaggctgcaggtaac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37788759 |
gcaatcaactttttgtcttcctcatgtgtccatgaaccttttctcaatccattattgtcacaaggggttctcaccatggtcactacaggctgcaggtaac |
37788660 |
T |
|
| Q |
120 |
tagcttttgtgctactaccaatt |
142 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
37788659 |
tagcttttgtactactaccaatt |
37788637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 194 - 238
Target Start/End: Complemental strand, 37788551 - 37788507
Alignment:
| Q |
194 |
tatatatatagggagactaattggagaagtggctttgatattagt |
238 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37788551 |
tatatatatagggagaataattggagaagtggctttgatattagt |
37788507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 96
Target Start/End: Complemental strand, 37807724 - 37807645
Alignment:
| Q |
20 |
gcaatcaactttttgtcttcctcatgtgtccatgaaccttttctcaatccattattgtcac---aaggggttctcaccat |
96 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||| || | |||||| ||||||| |||||||||||||||| |
|
|
| T |
37807724 |
gcaatcaactttttgtcttcctcgggtgtccatgtgcctttccttagtccatttttgtcacaataaggggttctcaccat |
37807645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University