View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2700_low_87 (Length: 227)

Name: NF2700_low_87
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2700_low_87
NF2700_low_87
[»] chr4 (1 HSPs)
chr4 (6-222)||(13827302-13827518)


Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 6 - 222
Target Start/End: Complemental strand, 13827518 - 13827302
Alignment:
6 actacattcgaacctttgaatcggcctcggtgaccaaataaccatcataaggacacgccctggtggtaccgacgacatacgtcaaacatggtttgcaata 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13827518 actacattcgaacctttgaatcggcctcggtgaccaaataaccatcataaggacacgccctggtggtaccgacgacatacgtcaaacatggtttgcaata 13827419  T
106 taaatgagtgcattgtgactgtaaagcttcattcggaaacacgagaaggcgacaaaccggacaaaaatactctccagcaagtgattgaatattgattata 205  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
13827418 taaatgagtgcattgtgactgcaaagcttcattcggaaacacgagaaggcgacaaacgggacaaaaatactctccagcaagtgattgaatattgattata 13827319  T
206 cattcattatcaaaacc 222  Q
    |||||||||||||||||    
13827318 cattcattatcaaaacc 13827302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University