View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_low_87 (Length: 227)
Name: NF2700_low_87
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_low_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 6 - 222
Target Start/End: Complemental strand, 13827518 - 13827302
Alignment:
| Q |
6 |
actacattcgaacctttgaatcggcctcggtgaccaaataaccatcataaggacacgccctggtggtaccgacgacatacgtcaaacatggtttgcaata |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13827518 |
actacattcgaacctttgaatcggcctcggtgaccaaataaccatcataaggacacgccctggtggtaccgacgacatacgtcaaacatggtttgcaata |
13827419 |
T |
|
| Q |
106 |
taaatgagtgcattgtgactgtaaagcttcattcggaaacacgagaaggcgacaaaccggacaaaaatactctccagcaagtgattgaatattgattata |
205 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13827418 |
taaatgagtgcattgtgactgcaaagcttcattcggaaacacgagaaggcgacaaacgggacaaaaatactctccagcaagtgattgaatattgattata |
13827319 |
T |
|
| Q |
206 |
cattcattatcaaaacc |
222 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13827318 |
cattcattatcaaaacc |
13827302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University