View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2700_low_91 (Length: 215)
Name: NF2700_low_91
Description: NF2700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2700_low_91 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 61 - 198
Target Start/End: Complemental strand, 46778790 - 46778653
Alignment:
| Q |
61 |
tcacataccaaatttctccttatcgttcttatatttgcggcttatattatggnnnnnnnattgcttgcccccttcacaatatttcttatgacttgtgaag |
160 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46778790 |
tcacataccaaatttccccttatcgttcttatatttgcggcttatattatggtttttttattgcttgccctcttcacaatatttcttatgacttgtgaag |
46778691 |
T |
 |
| Q |
161 |
gggttttgatccatccaataagtgcatgcacatgcaat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46778690 |
gggttttgatccatccaataagtgcatgcacatgcaat |
46778653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 46778887 - 46778812
Alignment:
| Q |
1 |
accaagttaattagttggctccggcttattaaccaaggaccataggtttgtgttgtgtggtcacataccaaatttc |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46778887 |
accaagttaattagttggctccggcttattaatcaaggaccataggtttgtgttgtgtggtcacataccaaatttc |
46778812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University